$VAR1 = 'strain'; $VAR2 = 'AFS088431'; $VAR3 = 'page'; $VAR4 = 'superalleleinfo'; $VAR5 = 'dbase'; $VAR6 = 'superdb'; $VAR7 = 'file'; $VAR8 = 'bcereusgrp_isolates.xml'; $VAR9 = 'locus'; $VAR10 = 'pyre'; Expires: Sat, 06 Mar 2021 17:16:29 GMT Date: Fri, 05 Mar 2021 17:16:29 GMT Content-Type: text/html; charset=ISO-8859-1 Bacillus cereus group Multi-Scheme MLST SuperDatabase

Information on pyre in strain B.cereus AFS088431

Locuspyre
AlleleComplete sequence
SequenceTGGAGCAGTATTTTTACAACCGAATGATCCATTTACTTGGTCTTCTGGTATGAAATCACC
AATTTATTGTGATAATCGTTTAACTTTATCTTATCCAAAAGTACGCCAAGCGATTGCAGC
TGGATTAGAAGAGTTAATTAAAGAGCACTTCCCAACTGTAGAAGTTATTGCAGGAACAGC
AACTGCTGGTATTGCGCACGCTGCATGGGTAAGCGATCGTATGGATTTACCGATGTGCTA
CGTACGTAGTAAAGCAAAAGGTCATGGTAAAGGGAACCAAATCGAAGGAAAAGCTGAAAA
AGGTCAAAAAGTAGTAGTAGTAGAAGACTTAATTTCAACTGGCGGTAGTGCAATTACATG
TGTAGAAGCACTTCGCGAAGCTGGCTGTGAAGTATTAGGAATCG