$VAR1 = 'strain'; $VAR2 = 'AFS067879'; $VAR3 = 'page'; $VAR4 = 'superalleleinfo'; $VAR5 = 'dbase'; $VAR6 = 'superdb'; $VAR7 = 'file'; $VAR8 = 'bcereusgrp_isolates.xml'; $VAR9 = 'locus'; $VAR10 = 'ftsa'; Expires: Fri, 26 Feb 2021 19:18:01 GMT Date: Thu, 25 Feb 2021 19:18:01 GMT Content-Type: text/html; charset=ISO-8859-1 Bacillus cereus group Multi-Scheme MLST SuperDatabase

Information on ftsa in strain B.toyonensis AFS067879

Locusftsa
AlleleComplete sequence
SequenceATGTTAAAGTCATCATTGGTGAAATGGTTAATGACAGCTTAAACATTATTGGTGTTGGAA
ATGTAAAATCGAATGGTTTAAAGAAGGGATCGATAGTCGATATAGATGAGACTGTTCGAT
CAATTAAAAAAGCAATTGAACAAGCTGAGCGCATGGTGGGAATCCACATTGAGCAAGTTG
TAGTAGGTGTCAATGCAAACCAGGTACAGCTACTTCCTTGTCATGGAGTAGTCGCTGTTT
CAAATGAAGATCGTGAAATCGGGAATGAAGATGTCTTACGCGTTCTAGATGCAGCACAAG
TTGTGTCAATTGCTCCAGAACGTGAGTTTATTGATGTGGTACCTCGACAGTTCATCGTAG
ACGGTCTTGACGAGATTAACGATCCACGTGGAATGATCGGT