$VAR1 = 'strain'; $VAR2 = 'AFS033440'; $VAR3 = 'page'; $VAR4 = 'superalleleinfo'; $VAR5 = 'dbase'; $VAR6 = 'superdb'; $VAR7 = 'file'; $VAR8 = 'bcereusgrp_isolates.xml'; $VAR9 = 'locus'; $VAR10 = 'glpt'; Expires: Mon, 08 Mar 2021 18:19:18 GMT Date: Sun, 07 Mar 2021 18:19:18 GMT Content-Type: text/html; charset=ISO-8859-1 Bacillus cereus group Multi-Scheme MLST SuperDatabase

Information on glpt in strain B.cereus AFS033440

Locusglpt
AlleleComplete sequence
SequenceCTATTTAAAGGACGTCGTGCACCTGCTGGTATTCTATTTATGGTCGGTGTATTTATCGCA
GTTCTTGTTTACTGGTTAAACCCTCCTGGTAATCCAATGGTTGATAGTATCGCACTTGTC
GCAATTGGATTTTTAATTTACGGACCGGTTATGTTAATTGGTCTACACGCTCTAGACTTA
GCACCAAAGAAAGCTGCTGGAACTGCAGCAGGCTTAACTGGATTCTTCGGTTACTTAGGC
GGAGCTGCTTTCGCTAGTGCAGCTATGGGCTTTATCGTAGATGCATTCGGATGGGATGGC
GGATTCATCTTATTACTTGCATCTTGCGTA