$VAR1 = 'strain'; $VAR2 = '2000031765'; $VAR3 = 'page'; $VAR4 = 'superalleleinfo'; $VAR5 = 'dbase'; $VAR6 = 'superdb'; $VAR7 = 'file'; $VAR8 = 'bcereusgrp_isolates.xml'; $VAR9 = 'locus'; $VAR10 = 'clpc'; Expires: Mon, 08 Mar 2021 18:44:30 GMT Date: Sun, 07 Mar 2021 18:44:30 GMT Content-Type: text/html; charset=ISO-8859-1 Bacillus cereus group Multi-Scheme MLST SuperDatabase

Information on clpc in strain B.anthracis 2000031765

Locusclpc
AlleleComplete sequence
SequenceTGAGCTGTCTATGGATGAAGCTCGTAAATTAGGTCATTCTTACGTTGGAACAGAACATAT
TTTACTTGGTTTAATCCGCGAAGGTGAAGGGGTAGCGGCACGCGTTTTAAATAACTTAGG
TGTTAGCCTAAATAAGGCAAGACAACAAGTATTGCAACTTCTTGGAAGTAATGAAGCAAG
TTCAGGTCACCAAGGTGGTTCTTCAACAAATGCAAATACACCAACACTTGATAGCTTAGC
GCGTGATTTAACAGTTGTTGCACGTGAAAATCGTTTAGACCCTGTTATTGGACGTGGTAA
AGAAATTCAACGTGTAATTGAAGTTTTAAGCCGTAGAACAAAAAACAATCCTGTATTAAT
CGGGGAGCCTGGTGTAGGTAAAACGGCAATTGCGGAAGGATTAGCACAACAAATCGTAAA
TAATGAAGTTCCTGAAACTTTACGAGATAAGCGTGTTATGACACTAGATATGGGTACAGT
GGTAGCTGGAACGAAATACC