$VAR1 = 'strain'; $VAR2 = 'CVUAS2833'; $VAR3 = 'page'; $VAR4 = 'alleleinfo'; $VAR5 = 'dbase'; $VAR6 = 'optimized'; $VAR7 = 'file'; $VAR8 = 'bcereusgrp_isolates.xml'; $VAR9 = 'allele'; $VAR10 = '36'; $VAR11 = 'locus'; $VAR12 = 'pta'; Expires: Mon, 01 Mar 2021 04:24:12 GMT Date: Sun, 28 Feb 2021 04:24:12 GMT Content-Type: text/html; charset=ISO-8859-1 Bacillus cereus group Tourasse-Helgason MLST Database

Information on pta-36

Locuspta
Allele36
SequenceAATTTAACATTAGCAGGCATTGATATTTATGATCCAGCTACATATGAAGAAATGGATGCA
ATGGTAGCGTCTTTCGTTGAGCGTCGTAAAGGGAAAGCAACAGAAGAAGATGCTCGTAAA
ATCTTAAAAGACGAAAACTACTTTGGCACAATGCTTGTATATATGGGAAAAGCACACGGT
CTAGTTAGTGGGGCAGCTCATTCTACAGCAGATACAGTTCGTCCGGCACTTCAAATCATT
AAAACAAAACCAGGCGTTACAAAAACTTCAGGCGTATTCATTATGGTACGTGAAGATGAG
AAATATGTATTCGCTGATTGTGCAATTAACATTGCACCAAACAGCCAAGACTTAGCTGAA
ATTGGTATTGAAAGCGCAAAAACGGCAGAATTATTCGGTATCGACCCACGCGTT