$VAR1 = 'strain'; $VAR2 = 'A0157'; $VAR3 = 'page'; $VAR4 = 'alleleinfo'; $VAR5 = 'dbase'; $VAR6 = 'optimized'; $VAR7 = 'file'; $VAR8 = 'bcereusgrp_isolates.xml'; $VAR9 = 'allele'; $VAR10 = '32'; $VAR11 = 'locus'; $VAR12 = 'pta'; Expires: Tue, 02 Mar 2021 17:01:02 GMT Date: Mon, 01 Mar 2021 17:01:02 GMT Content-Type: text/html; charset=ISO-8859-1 Bacillus cereus group Tourasse-Helgason MLST Database

Information on pta-32

Locuspta
Allele32
SequenceAATTTAACATTAGCAGGCGTTGATATTTACGATCCAGCTACATACGAAGAAATGGATGCA
ATGGTAGCATCTTTCGTTGAACGCCGTAAAGGTAAAGCAACAGAAGAAGACGCTCGCAAA
ATCCTTAAAGACGAAAATTACTTCGGTACAATGCTTGTATACATGGGCAAAGCACACGGT
TTAGTAAGTGGTGCAGCTCACTCTACAGCTGATACAGTTCGTCCAGCACTTCAAATTATT
AAAACAAAACCAGGCGTTACAAAAACTTCTGGCGTATTCATCATGGTACGTGAAGAAGAG
AAATATGTATTTGCTGATTGCGCAATTAACATTGCACCAAATAGCCAAGATTTAGCTGAA
ATTGGTATCGAGAGTGCGAAAACTGCTGAACTATTCGGTATTGACCCACGCGTT