$VAR1 = 'strain'; $VAR2 = '03BB102'; $VAR3 = 'page'; $VAR4 = 'alleleinfo'; $VAR5 = 'dbase'; $VAR6 = 'optimized'; $VAR7 = 'file'; $VAR8 = 'bcereusgrp_isolates.xml'; $VAR9 = 'allele'; $VAR10 = '2'; $VAR11 = 'locus'; $VAR12 = 'adk'; Expires: Mon, 01 Mar 2021 04:32:02 GMT Date: Sun, 28 Feb 2021 04:32:02 GMT Content-Type: text/html; charset=ISO-8859-1 Bacillus cereus group Tourasse-Helgason MLST Database

Information on adk-2

Locusadk
Allele2
SequenceAAAGGTGCACTTGTTCCAGATGAAGTTACAATCGGAATCGTTCGTGAACGTTTAAGCCAA
GAAGACTGTGTAAGAGGCTTCTTATTAGATGGTTTCCCACGAACTGTTGCACAAGCATCA
GCTCTTGAAGAGATTATGAAAGATCTTGGCAAAAAAATCGACTATGTTTTAAACATTAAT
GTGGATTCAGGGTTGTTATTAAAACGCCTTACAGGCCGTCGCATTTGTAAAGAGTGCGGT
GCGACTTACCACTTAGAATTCAATGCGCCAGCAAAAGCTGACGTGTGCGATAAATGTGGT
GGCGAATTATATCAACGCTCTGATGACAATGAAGAAACTGTAGCAAATCGCTTAGATGTA
AATATTAAGCAAACTAAACCTTTGCTTGATTTCTACGAGGAGCTTGGTTAC