$VAR1 = 'strain'; $VAR2 = 'AFS070662'; $VAR3 = 'page'; $VAR4 = 'superalleleinfo'; $VAR5 = 'dbase'; $VAR6 = 'hyperdb'; $VAR7 = 'file'; $VAR8 = 'bcereusgrp_isolates.xml'; $VAR9 = 'locus'; $VAR10 = 'clpc'; Expires: Sat, 27 Feb 2021 06:54:50 GMT Date: Fri, 26 Feb 2021 06:54:50 GMT Content-Type: text/html; charset=ISO-8859-1 Bacillus cereus group Multi-Datatype MLST+AFLP+MLEE SuperDatabase

Information on clpc in strain B.cereus AFS070662

Locusclpc
AlleleComplete sequence
SequenceTGAATTGTCTATGGATGAAGCGCGTAAGCTAGGACATTCTTACGTTGGAACAGAACATAT
TTTACTTGGCTTAATCCGTGAAGGTGAAGGTGTAGCGGCACGTGTTTTAAATAATTTAGG
CGTCAGCCTTAACAAAGCAAGACAACAAGTGTTACAACTTCTTGGAAGTAACGAAGCAAG
TTCAGGTCACCAAGGTGGTTCATCGACAAATGCAAATACACCGACACTAGACAGTTTAGC
GCGCGACTTAACAGTTGTTGCACGTGAGAATCGTTTGGATCCTGTTATTGGACGTAGTAA
AGAAATTCAACGTGTAATTGAAGTGTTAAGCCGTAGAACAAAAAACAATCCAGTGTTAAT
TGGAGAGCCTGGTGTAGGTAAAACAGCAATTGCTGAAGGGTTAGCACAGCAAATCGTAAA
TAATGAAGTTCCTGAAACGTTAAGAGATAAGCGTGTTATGACACTAGATATGGGAACAGT
GGTAGCTGGGACGAAATATC