$VAR1 = 'strain'; $VAR2 = 'AFS019518'; $VAR3 = 'page'; $VAR4 = 'superalleleinfo'; $VAR5 = 'dbase'; $VAR6 = 'hyperdb'; $VAR7 = 'file'; $VAR8 = 'bcereusgrp_isolates.xml'; $VAR9 = 'locus'; $VAR10 = 'rpob'; Expires: Sun, 28 Feb 2021 10:26:51 GMT Date: Sat, 27 Feb 2021 10:26:51 GMT Content-Type: text/html; charset=ISO-8859-1 Bacillus cereus group Multi-Datatype MLST+AFLP+MLEE SuperDatabase

Information on rpob in strain B.thuringiensis AFS019518

Locusrpob
AlleleComplete sequence
SequenceCGTCTGCGTTCTGTTGGAGAACTATTACAAAATCAATTCCGTATCGGTCTTTCTCGTATG
GAACGTGTTGTTCGTGAGAGAATGTCGATCCAAGATACAAATGCAATTACACCACAGGCA
CTAATTAATATTCGTCCTGTTATTGCATCTATTAAAGAGTTCTTCGGAAGTTCTCAGTTA
TCTCAGTTCATGGACCAAACAAATCCATTAGCGGAGTTAACTCACAAACGAAGACTATCT
GCATTAGGACCTGGTGGTTTAACGCGTGAGCGCGCAGGGTTTGAAGTACGTGACGTTCAT
TACTCCCATTATGGTCGT