$VAR1 = 'strain'; $VAR2 = 'AFS003807'; $VAR3 = 'page'; $VAR4 = 'superalleleinfo'; $VAR5 = 'dbase'; $VAR6 = 'hyperdb'; $VAR7 = 'file'; $VAR8 = 'bcereusgrp_isolates.xml'; $VAR9 = 'locus'; $VAR10 = 'yhfl'; Expires: Sat, 06 Mar 2021 20:31:52 GMT Date: Fri, 05 Mar 2021 20:31:52 GMT Content-Type: text/html; charset=ISO-8859-1 Bacillus cereus group Multi-Datatype MLST+AFLP+MLEE SuperDatabase

Information on yhfl in strain B.cereus AFS003807

Locusyhfl
AlleleComplete sequence
SequenceTAGATGAAGAAGATGTAGCGGTTATTCTATATACTTCGGGCACAACTGGAAAACCGAAAG
GCGCTATGTTAACACATAAAAATTTATATAGTAATGCGAACGATGTGGCGTCGTATTTAC
AATATACGGCTGATGACCGCGTTGTTGCGGCACTGCCTATGTTCCATGTATTCTGTTTAA
CAGTTGCGGTAAATGCACCGATTGTGAACGGGGCAACGATTTTAATGTTACCGAAATTTA
GTCCGAAAGAAGTATTCCGTATTTGTCGCACGTACGAACCAACGATCTTTGCTGGCGTAC
CGACAATGTACAATTATTTATATTTATTTGAAGAAGCAAGCGCAGAAGATGTGAAGACGC
TTCGTCTTTGTATTTCCGGTGGTGCATCAATGCCTGTTGCTCTTCTGCAAAACTTTGAAA
AACGTTTTAACGTTATTGTTTCAGAAGGATACGGTTTATCAGAAGCATCACCAGTTACTT
GTTTCAATCCGCTAGATCGT