Information on tpi in strain B.cereus 25R6

Locustpi
AlleleComplete sequence
SequenceGAATCAGTAAACAAAAAGACTCTTGCAGCATTTGAACATGGTTTAACACCAATCGTTTGT
TGTGGTGAGACTTTAGAAGAGCGCGAAAGCGGAAAAACATTTGATCTAGTAGCAGGTCAA
GTAACAAAAGCACTTGCAGGTTTAACAGAAGAGCAAGTTAAAGTAACTGTTATCGCTTAT
GAGCCAATCTGGGCTATCGGTACAGGTAAATCTTCTTCTTCTGCAGATGCAAATGAAGTA
TGTGCGCACATCCGTAAAGTTGTTGCAGAAGCTGTTTCTCCAGAAGCTGCAGAAGCTGTT
CGTATTCAATACGGCGGTAGCGTAAAACCAGAAAACATTAAAGAGTATATGGCACAATCT
GACATCGACGGCGCTTTAGTTGGCGGTGCTAGCTTAGAGCCTGCTTCGTTCTTAGGTCTT
CTGGGGGCGGTAAAA

SuperCAT Home