Information on ilvd in strain B.cereus 25R6

Locusilvd
AlleleComplete sequence
SequenceGAAGAAGGAGGATTACGTATATTAAAAGGAAACCTTGCGAAAGACGGAGCGGTTATTAAA
AGCGGAGCAACAGAAGTAAAACGATTTGAAGGACCTTGCGTTATTTTTAATTCACAAGAT
GAGGCGCTTGCCGGCATTATGCTTGGGAAAGTTAAGAAAGGAGATGTAGTTGTTATTCGC
TATGAAGGACCAAGAGGCGGACCTGGTATGCCGGAAATGTTAGCACCAACATCAGCAATT
GCTGGTATGGGATTAGGAGCAGATGTTGCACTTTTAACTGATGGTCGCTTCTCTGGTGCT
TCACGTGGTATTTCGGTAGGGCACATTTCACCAGAAGCAGCAGCTGGCGGAACGATTGCA
CTTCTTGAACAAGGAGATATTGTATGTATTGAT

SuperCAT Home