Information on glpf in strain B.cereus 25R6

Locusglpf
AlleleComplete sequence
SequenceGCAGCGTATGCAGTTGGATCAATTAGTGGGGCACATTTGAATCCGGCTTTAACGATAGGA
CTTGCTTTTAAGGGAGCGTTCCCATGGAGTGATGTACCTATGTATATCGCAGCACAAATG
ATTGGGGCAATTATCGGGGCAGTTCTTGTATATTTACATTACTTACCACACTGGAAAGAA
ACAGAAGATCCAGGAACAAAGTTAGGTGTATTTGCAACAGGTCCAGCAATTCCGAACACA
TTTACAAACCTTTTAAGTGAAATGATTGGAACATTCGTTTTAGTATTTGGTATATTAGCA
ATTGGAGCAAATAAATTTGCAGATGGTTTAAATCCATTTATCGTAGGTTTCTTAATTGTA
AGTATTGGTTTA

SuperCAT Home