Information on pyca2 in strain B.cereus 2002734484

Locuspyca2
AlleleComplete sequence
SequenceTACTATGCACCGTTTGAAAGTGGTATGAATGCGCCGCATACAGAGGTATATATGCATGAA
ATGCCGGGTGGGCAGTATAGTAATCTTCAGCAACAAGCGAAGGCGGTTGGTTTAGGAGAT
CGCTTCGATGAAGTGAAAGTAATGTACCGCCGTGTGAATGACATGTTTGGAGATATTGTA
AAAGTAACGCCATCATCAAAAGTTGTTGGTGATATGGCATTATTTATGGTTCAGAACCAT
CTGACAGAACAAGATGTTTTAGAGCGTGGACATGCGATGGACTTCCCAGGGTCTGTTGTT
GAAATGTTCTCTGGTGATTTAGGTCAACCGTACGGTGGTTTCCCGAAAGAATTACAAAAG
ATT

SuperCAT Home