Information on purh in strain B.cereus 2002734484

Locuspurh
AlleleComplete sequence
SequenceAAACGTAAACTAGCAGCGAAAGTATTCCGTCATACAGCAGCGTATGATGCGTTAATTTCT
AACTACTTAACAGAGCAAATGGGTGAAGAAAGTCCAGAAACATTAACTGTGACATTTGAG
AAAAAGCAAGACTTACGTTATGGCGAGAACCCACATCAAAAGGCAACTTTCTATAAAGCG
CCATTCGCAGCAACTTCTTCTGTTGCATACGCAGAACAATTACACGGTAAAGAATTATCG
TATAACAATATTAATGATGCAGACGCAGCGCTTAGCATCGTAAAAGAATTTACAGAACCA
GCAGTAGTAGCAGTAAAACATATGAATCCATGTGGTGTTGGAGTAGGA

SuperCAT Home