Information on tpi in strain B.anthracis 2000031031

Locustpi
AlleleComplete sequence
SequenceGAGTCAGTAAACAAAAAGACTATTGCAGCATTTGAACATGGTTTAACACCAATCGTATGT
TGTGGTGAGACTTTAGAAGAGCGCGAAAGCGGAAAAACATTTGATCTAGTAGCAGGTCAA
GTGACAAAAGCACTTGCAGGTTTAACAGAAGAGCAAGTTAAAGCAACTGTTATCGCTTAT
GAGCCAATCTGGGCTATCGGTACAGGTAAATCTTCTTCTTCTGCAGATGCAAACGAAGTA
TGTGCGCACATCCGTAAAGTTGTTGCAGAAGTTGTTTCTCCAGCTGCTGCAGAAGCTGTT
CGTATCCAATACGGCGGTAGCGTAAAACCAGAAAACATTAAAGAGTACATGGCACAATCT
GACATCGACGGCGCTTTAGTTGGCGGTGCTAGCTTAGAGCCTGCTTCGTTCTTAGGTCTT
CTGGGGGCGGTAAAA

SuperCAT Home