Information on succ in strain B.anthracis 2000031031

Locussucc
AlleleComplete sequence
SequenceTCTTTAAAGAATATATTGATCCAGCAGTAGGTTTACAAGGCTTCCAAGCACGCCGGATTG
CATTTAACATCAATATTCCAAAAGAGCTTGTAGGACAAGCTGTGAAGTTTATGATGGGCT
TATACCGTGCGTTTATCGAAAAAGATTGTTCTATCGCAGAGATTAATCCACTTGTTACAA
CAGGTGACGGTAAAGTTATGGCATTAGATGCGAAATTAAACTTTGATTCTAACGCTTTAT
ATCGCCATAAAGACATTTTAGAACTTCGTGATCTTGATGAAGAAGATGCAAAAGAAATCG
AAGCTTCTAAATATGACTTAAACTACATTCCTTTAGATGGAAATATCGGTTGTATGGTTA
ATGGTGCAGGTTTAGCGATGGCTACGATGGATATCATTAAACATTACCATGGCGATCCAG
CTAACTTCTTAGATGTTGGTGGCGGTGCGACAGCTGAAAAAGTTACAGAAGCATTTAAAA
TTATCCTTTCTGACAAAAATGTAA

SuperCAT Home