Information on recf in strain B.anthracis 2000031031

Locusrecf
AlleleComplete sequence
SequenceAAGATTTCGGTCAAATTAAAGGAAAGTTACAAAAGAGAAATAGTTCTTTGTCTTTGGAAT
TAAATATCTCGAAAAAAGGTAAAAAGGCAAAATTAAATCAACTTGAACAACAAAAATTGA
GTCAATATATTGGCGTGATGAATGTTGTCATGTTTGCCCCAGAAGATTTAAATCTTGTAA
AAGGAAGCCCTCAAGTAAGAAGACGCTTTTTAGATATGGAATTAGGCCAAATAGCTCCGG
TCTATTTGTATGAATTGAGTCAATATCAAAAGGTGCTCACACAACGAAATCACTTGCTGA
AAAAGATGCAAGGGAATAGTAAGAATGAGGAAACGATGTTGGATGTATTTACACTTCAAC
TTATTGAGCATGGTACAAAAATATTGCGAAAACGCTTTGAGTTTTTGCATTTACTACAAG
AATGGGCAGCTCCAATTCATCGTGGTATAAGCCGTGGATTAGAAGAATTA

SuperCAT Home