Information on pyca2 in strain B.anthracis 2000031031

Locuspyca2
AlleleComplete sequence
SequenceTACTACGCACCGTTTGAAAGTGGTATGAACGCTCCTCATACAGAGGTATATATGCACGAA
ATGCCAGGCGGACAGTACAGTAATTTACAACAACAAGCGAAAGTGGTTGGCTTAGGCGAT
CGCTTCGATGAAGTGAAAGTAATGTATCGCCGTGTGAATGATATGTTTGGTGATATTGTT
AAAGTAACGCCATCATCTAAAGTTGTCGGTGATATGGCATTATTCATGGTTCAAAATCAC
TTAACAGAACAAGATGTTTTAGAGCGTGGACATTCTATGGACTTCCCAGGATCTGTTGTT
GAAATGTTCTCTGGAGACTTAGGACAACCATATGGTGGTTTCCCGAAAAAGTTACAAGAA
ATT

SuperCAT Home