Information on pta in strain B.anthracis 2000031031

Locuspta
AlleleComplete sequence
SequenceAATTTAACATTAGCAGGCGTTGATATTTACGATCCAGCTACATACGAAGAAATGGATGCA
ATGGTAGCATCTTTCGTTGAACGCCGTAAAGGTAAAGCAACAGAAGAAGACGCTCGCAAA
ATCCTTAAAGACGAAAATTACTTCGGTACAATGCTTGTATACATGGGCAAAGCACACGGT
TTAGTAAGTGGTGCAGCTCACTCTACAGCTGATACAGTTCGTCCAGCACTTCAAATTATT
AAAACAAAACCAGGCGTTACAAAAACTTCTGGCGTATTCATCATGGTACGTGAAGAAGAG
AAATATGTATTTGCTGATTGCGCAATTAACATTGCACCAAATAGCCAAGATTTAGCTGAA
ATTGGTATCGAGAGTGCGAAAACTGCTGAACTATTCGGTATTGACCCACGCGTT

SuperCAT Home