Information on panc in strain B.anthracis 2000031031

Locuspanc
AlleleComplete sequence
SequenceCAAACGACAACGGTAGAAGTTGTGAAGCGTACCGATGTATTATGCGGTAAACAAAGACCA
GGTCATTTCGCTGGTGTTGCGACTGTACTCATGAAACTATTTAACATTACATTGCCAACA
CGCGCGTATTTCGGTATGAAAGATGCACAGCAAGTTGCTGTCATTGAAGGATTTGTCGCT
GATTTTAATATTCCGGTTATAATCGTACCGGTGGATATTGTAAGGGAAGAAGATGGATTA
GCGAAAAGTTCTCGTAACGTGTATTTATCACAAAAAGAGCGTAAAGAGGCTCCTCATTTA
TACCGCAGTCTATGTATGGCAAAAGAAAGAATTGAGGCAGGAGAACGGAA

SuperCAT Home