Information on muts in strain B.anthracis 2000031031

Locusmuts
AlleleComplete sequence
SequenceAAAAGTACGTATATGAGACAATTAGCACTTGTAACAGTTATGTCGCAAATCGGTTGTTTC
GTACCAGCAACAGAAGCAGTATTACCTGTATTTGACCAAATCTTTACGAGAATTGGTGCA
GCGGATGATTTAATTTCAGGTCAAAGTACATTTATGGTTGAAATGTTAGAAGCAAAAAAC
GCAATTGCAAACGCATCAGAAAGAAGTTTAATTTTATTCGATGAAATTGGACGCGGTACA
TCTACGTATGATGGTATGGCACTTGCACAAGCAATCATTGAACATATTCATGACCAAATT
GGTGCGAAAACGTTATTCTCTACGCATTATCATGAATTGACTGTGCTAGAAGACAGTTTA
GATCAAC

SuperCAT Home