Information on mbl in strain B.anthracis 2000031031

Locusmbl
AlleleComplete sequence
SequenceGGTGGAGGTACAACGGATATCGCTGTACTATCTATGGGTGATATTGTTACCTCTTCCTCT
ATCAAAATGGCTGGCGATAAGTTTGATATGGAGATCTTAAACTACATTAAACGTAAGTAT
AAGCTATTAATCGGAGAACGTACTTCAGAAGATATTAAAATTAAAGTTGGTACAGTATTC
CCAGGTGCACGTAGTGAAGAACTTGAAATTCGCGGACGTGACATGGTAACAGGTTTACCA
CGCACAATTACAGTATGTTCTGAAGAAATTACAGAAGCATTAAAAGAAAATGCAGCTGTT
ATTGTACAAGCTGCAAAAGGCGTACTAGAGCGCACACCACCAGAATTATCAGCGGATATC

SuperCAT Home