Information on glpf in strain B.anthracis 2000031031

Locusglpf
AlleleComplete sequence
SequenceGCAGCGTACGTGGTTGGATCAATTAGTGGGGCACATTTGAATCCAGCTTTGACGATAGGA
TTAGCATTTAAGGGAGCGTTCCCATGGGGTGACGTACCTGGTTATATCGCAGCACAAATG
ATTGGGGCAATTATCGGGGCAGTTATCGTATATTTACATTACTTACCACACTGGAAAGAA
ACAGAAGATCCAGGAACAAAGTTAGGTGTATTTGCAACAGGTCCAGCAATTCCGAACACA
TTTGCAAACCTTTTAAGTGAAATGATTGGGACATTCGTTTTAGTATTTGGTATATTAGCA
ATTGGTGCAAATAAATTTGCAGATGGATTAAATCCATTTATCGTAGGTTTCTTAATTGTA
AGTATTGGTTTA

SuperCAT Home