Information on ccpa in strain B.anthracis 2000031031

Locusccpa
AlleleComplete sequence
SequenceATCAATGAAAGGACCAGAGACGAAACCGATACGCTTATGTCCTTGTTCAATAAAGTGCTT
CATTGCGTCGTAAGCTGCTTGTGTATAATCAATGTTTACTGATGGCGTTTCATTTTGCTC
ATCAAATGACGCTGCTAATACGATTGGTACTGGAGACTTTTTAAATTCTTCAATGTGAAT
GTCTGTAATATCTTCACCCATGAAAACAATTCCGTCCACTTGTTTTCCAAGCATCGTATT
TAATAAATGGAACTCTTTCTCTTTGTTTTGGTCAGAGTTACTTAAAATGATGTTATATTT
GTACATTGTTGCGATATCTTCAATTCCACGAGCAAGTTCTGCATAAAACGTATTTGAGAT
ATCAGGAATAATAACACCTACTGTAGTCGTCTTCTTACTTGCTAATCCACGTGCTACC

SuperCAT Home