Information on adk in strain B.anthracis 2000031031

Locusadk
AlleleComplete sequence
SequenceAAAGGTGCACTTGTTCCAGATGAAGTTACAATCGGAATTGTTCGTGAACGTTTAAGCCAA
GAAGACTGTGTAAGAGGCTTCTTATTAGATGGTTTCCCACGAACTGTTGCACAAGCATCA
GCTCTTGAAGAGATTATGAAAGATCTTGGCAAAAAAATCGACTATGTTTTAAACATTAAT
GTGGATTCAGGGTTGTTATTAAAACGCCTTACAGGCCGTCGCATTTGTAAAGAGTGCGGT
GCGACTTACCACTTAGAATTCAATGCGCCAGCAAAAGCTGACGTGTGCGATAAATGTGGT
GGCGAATTATATCAACGCTCTGATGACAATGAAGAAACTGTAGCAAATCGCTTAGATGTA
AATATTAAGCAAACTAAACCTTTGCTTGATTTCTACGAGGAGCTTGGTTAC

SuperCAT Home