Bacillus cereus group Sequence Query

Here you can perform a BLASTN search against all the MLST loci and alleles in the database using one or more query sequences (as many as you like), in order to select isolates that have allele sequences matching your query. Your sequence(s) must be in FASTA format as described below. Blank lines and whitespace characters will be ignored.

Input file format (FASTA):
>query1
ATGCATGAAGTAGCGATCAGCATGATGA
GATGATACACGTACGTACAGACTAGCAT
...
>myseq2
GTACGTAGGGGACAGTACTTACATCATG
CGCGTACCACAGTACAGTTTACATGACC
...

Paste one or more sequences (DNA) below:

Or upload a sequence file (in text format): 
Press the "BLAST sequences" button to BLAST your sequences. BLASTN will be performed with default values for all parameters, with the exception of an increased nucleotide match reward (r = 2), and e-value of 1e-05 (e = 1e-05) and no filtering of low-complexity regions.



TH Database Home