Information on recf in strain B.cereus 3A

Locusrecf
AlleleComplete sequence
SequenceAAGATTTCGGTCAAATTAAAGGAAAGTTACAAAAGAGAAATAGTTCTTTGTCTTTGGAAT
TAAATATCTCGAAAAAAGGTAAAAAGGCAAAATTAAATCAACTTGAACAACAAAAATTGA
GTCAATATATTGGCGTGATGAATGTTGTCATGTTTGCCCCAGAAGATTTAAATCTTGTAA
AAGGAAGCCCTCAAGTAAGAAGACGCTTTTTAGATATGGAATTAGGCCAAATAGCTCCGG
TCTATTTGTATGAATTGAGTCAATATCAAAAGGTGCTCACACAACGAAATCACTTGCTGA
AAAAGATGCAAGGGAATAGTAAGAATGAGGAAACGATGTTGGATGTATTTACACTTCAAC
TTATTGAGCATGGTACAAAAATATTGCAAAAACGCTTTGAGTTTTTGCATTTACTACAAG
AATGGGCAGCTCCAATTCATCGTGGTATAAGCCGTGGATTAGAAGAATTA

HyperCAT Home