Information on pyca1 in strain B.cereus 3A

Locuspyca1
AlleleComplete sequence
SequenceTTAGCAGATGAAGAGGGCAATGTTGTTCATTTATACGAGCGAGACTGTTCTGTACAACGT
CGTCACCAAAAAGTAGTAGAAATTGCACCTAGTGTGTCGCTTTCAGATGATTTGCGTCAG
CGTATTTGTGAAGCTGCTGTAAAGTTAACGAAAAATGTAAATTATTTAAACGCAGGAACA
GTTGAATTCCTTGTTAAAGATGATAATTTCTATTTCATTGAAGTAAATCCACGTGTTCAA
GTAGAACATACAATTACAGAAATGATTACAGGAGTTGACATCGTTCAATCGCAAATTTTA
ATAGCTGATGGACATGCATTACATAGTAAAATGGTAGGTGTTCCAAAGCAAGAGGAAGTG
GTTGTGCACGGTTTTGCAA

HyperCAT Home