Information on panc in strain B.cereus 3A

Locuspanc
AlleleComplete sequence
SequenceCAAACGACAACGGTAGAAGTTGTGAAGCGTACCGATGTATTATGCGGTAAACAAAGACCA
GGTCATTTCGCTGGTGTTGCGACTGTACTCATGAAACTATTTAACATTACATTGCCAACC
CGCGCGTATTTCGGTATGAAAGATGCACAGCAAGTTGCTGTCATTGAAGGATTTGTCGCT
GATTTTAATATTCCGGTTATAATCGTACCGGTGGATATTGTAAGGGAAGAAGATGGATTA
GCGAAAAGTTCTCGTAACGTGTATTTATCACAAGAAGAGCGTAAAGAGGCTCCTCATTTA
TACCGCAGTCTATGTATGGCAAAAGAAAGAATTGAGGCAGGAGAACGGAA

HyperCAT Home