Information on mdh in strain B.cereus 3A

Locusmdh
AlleleComplete sequence
SequenceCCAAGAACAAATCCTGTAATGTCTTTCACAGAAAGATTTAATTCTTGTGCGATGAATGTA
CGGAAACGAGCTGTATCTAATACGCCCGATTGACCGATAACACGCTCTTTCGGGAATCCT
GCTTCTTTAAATACAGAATATGTCATTGCATCAACTGGATTTGTTAATACAACAATAATC
GCATTTGGTGAATGTTTTGCAATGTCGCGCGTAATACTTTTCATAATTTTGGAGTTTGTT
GCTACTAAATCATCACGGCTCATACCAGGCTTACGCGC

HyperCAT Home