Information on mbl in strain B.cereus 3A

Locusmbl
AlleleComplete sequence
SequenceGGTGGAGGTACAACGGATATCGCTGTACTATCTATGGGTGATATTGTTACCTCTTCCTCT
ATCAAAATGGCTGGCGATAAGTTTGATATGGAGATCTTAAACTACATTAAACGTAAGTAT
AAGCTATTAATCGGAGAACGTACTTCAGAAGATATTAAAATTAAAGTTGGTACAGTATTC
CCAGGTGCACGTAGCGAAGAACTTGAAATTCGCGGACGTGACATGGTAACAGGTTTACCA
CGCACAATTACAGTATGCTCTGAAGAAATTACAGAAGCATTAAAAGAAAATGCAGCTGTT
ATTGTACAAGCTGCAAAAGGCGTACTAGAGCGCACACCACCAGAATTATCAGCGGACATC

HyperCAT Home