Information on ilvd in strain B.cereus 3A

Locusilvd
AlleleComplete sequence
SequenceGAAGAAGGTGGATTACGTATATTAAAAGGAAACCTTGCGAAAGACGGAGCAGTTATTAAA
AGCGGGGCAACTGAAGTAAAACGATTTGAAGGACCTTGTGTTATTTTTAATTCACAAGAT
GAGGCGCTTGCCGGCATTATGCTTGGGAAGGTTAAGAAAGGAGATGTAGTTATTATTCGT
TATGAAGGACCAAGAGGCGGTCCTGGTATGCCGGAAATGTTAGCACCAACGTCAGCGATT
GCTGGCATGGGATTAGGTGCGGATGTTGCGTTATTAACCGATGGTCGTTTCTCTGGTGCT
TCACGTGGTATTTCAGTAGGTCATATTTCGCCAGAAGCAGCTGCGGGCGGAACGATTGCA
CTTCTTGAACAAGGGGATATCGTTTGTATCGAT

HyperCAT Home