Information on gmk in strain B.cereus 3A

Locusgmk
AlleleComplete sequence
SequenceGTTCTTTCAGGACCTTCTGGTGTTGGGAAAGGAACGGTTCGAAAAGAGCTGTTTAGTCAT
GAGGATACACGTTTTCAGTACTCCATTTCAGTAACGACACGTAAGCCACGTGAAGGTGAA
GTGGATGGTGTGGATTATTTCTTTAAAGAGAGAGAAGAATTTGAGGAAATGATTCGTAAT
GAAAAATTACTTGAGTGGGCTGAGTTCGTAGGTAATTATTACGGAACACCAATTGACTAT
GTTGAAAAAACATTGCAAGAAGGAAAAGATGTATTCTTAGAAATTGAAGTGCAAGGAGCA
ATTCAAGTTAAGAAAGCTTTCCCAGAAGGTGTATTTATTTTCTTAGCACCTCCAAGTTTA
TCTGAACTAAAGAACCGAATTGTCGGTCGTGGTACAGAAACTGAAGATGTTATTGAAAAT
CGTTTAACGGTAGCGAAAGAAGAAATTGATATGATGGACGCTTACGACTACGTTGTAGAA
AACGACCAAGTTGAACTAGCTTGT

HyperCAT Home