Information on gdpd in strain B.cereus 3A

Locusgdpd
AlleleComplete sequence
SequenceCTTATCTTTACGGAATTTGCGGTGCTTATTATTATTTCGTACTTTGCTCATAAAAGGCAA
AAGGTGAGATTACGTCCAATTTTGTATAAAACAGTAACGTATTTACCTACTCTTTTCACA
TATTGCTTACCGGGATTTATTTTATATGCTGTCGTATTATTACCTCTTTTAAATATGGGA
TATGAAACAGCATTAATCCCGCAAATTCAAATTCCTAACTTCATTACAGGAGAACTGTTT
AAGACAACGATGGGACAAGTGGGTTATTACACATTCTTTGCTGTAGTTGCGTATTTGAAC
CTTCGCTGGATTTTTGTTCTACCTATTGTTGTTTTAGAACAAAAGCCATTTCGTGTGGCA
GCACGTAAAAGTGCAAAGTTAGTAAAAGAAAGCTTTTTTAAAGTACTATTCTTTTTAGTA
GGATTTTTTATTTCGATAGGAATTGTCTATGTCCTATTTTTAGGAATATATTTATTATGT
CTATGGGGTGTTTATGAATT

HyperCAT Home