Bacillus cereus group MLST, AFLP, and MLEE Data Information and Submission

Data sources, curation, access, and availability

For MLST data, strain information and sequences provided in this website have been retrieved and compiled from various public sources and databases such as the "pubmlst.org/bcereus" repository for the Priest MLST scheme, the Genbank nucleotide sequence database, and the published literature (see the MLST Schemes page of the SuperCAT database for a complete list of B. cereus group MLST publications). The website also includes data for strains that have been typed in our research group at the University of Oslo or in the laboratory of our collaborators at the Pasteur Institute in Paris, France, using the Helgason or Tourasse-Helgason MLST schemes. Phylogenetic information based on AFLP was taken from the large-scale studies of Ticknor et al. 2001, Hill et al. 2004, and Guinebretiere et al. 2008. For the latter study, isolate information and the AFLP-based phylogenetic tree were kindly provided by Dr. Marie−Hélène Guinebretière, INRA−University of Avignon, France. MLEE typing data and phylogenetic tree were obtained from an unpublished analysis conducted by Dr. Erlendur Helgason, a former member of our research group. This analysis was an extension of the study reported in Helgason et al. 2000, in which a number of additional isolates were subsequently added.

The databases provided on this website are maintained by Dr. Nicolas J. Tourasse. The data gathered from the various sources listed above are manually curated. The strain informations obtained from multiple sources are merged into a common description in order to build the final combined dataset.

All strain information data, sequences, tables of genetically identical strains, superclusters of genetically closely related strains, and phylogenetic trees, including user-made phylogenies, supertrees, and extracted subtrees, as well as genetic and phylogenetic networks and population snapshots can be browsed, searched, saved, and downloaded freely from the database. If you use data from this website in publications, you are kindly asked to acknowledge the website, preferably as below:
"This publication made use of the University of Oslo's Bacillus cereus group MultiLocus and MultiData Typing website (http://mlstoslo.uio.no)"

Submitting new data

Users are encouraged to submit data for inclusion in the Tourasse-Helgason scheme-specific MLST database, the multi-scheme MLST SuperCAT database, and/or the multi-datatype MLST+AFLP+MLEE HyperCAT database. Data may be sequences of MLST genes, or phylogenetic or genotyping information from AFLP or MLEE analysis, along with associated strain information. For this, please contact Dr. Nicolas J. Tourasse (nicolas.tourasse@inserm.fr), ARNA Laboratory, INSERM UMR 869, University of Bordeaux, France, or Prof. Anne−Brit Kolstø (a.b.kolsto@farmasi.uio.no), Laboratory for Microbial Dynamics (LaMDa), Department of Pharmaceutical Biosciences, University of Oslo, Norway.

Strain information data to be submitted should be organized in a tabular format similar to the one used for genomic data based on the "Minimal Information about a Genome Sequence (MIGS)". In case of numerous strains, a spreadsheet with the appropriate columns can be submitted. In addition, a sequence file in FASTA format should be provided for MLST data, while a phylogenetic tree should be provided for AFLP and MLEE data. The tree may be in any format (e.g., Newick/NewHampshire or NEXUS/PAUP). Alternatively, a picture of the tree in any image format may be provided. Examples of submission files are shown below.

Tabular format for submitting strain information:
strain97-27
descriptionB.thuringiensis konkukian 97-27 (97/027, CEB97/27, CEB97/027)
sourceHuman, tissue necrosis (1995)
locationYugoslavia, Bosnia-Herzegovina, Sarajevo
AFLPHill et al. 2004 (AFLP2)
MLEEHelgason et al. 2000
MLST scheme(s)Candelon-Sorokin Helgason Ko Priest Tourasse-Helgason

Spreadsheet format for submitting large numbers of strains:
straindescriptionsourcelocationAFLPMLEEMLST scheme(s)
A0465B.anthracis LSU465 (K2762, A0465, RA3, 6445/RA3)Animal, cattle (Cow), spleen (1997) [pXO1+/pXO2+]France, Pyrenees mountainsHill et al. 2004 (AFLP2) Candelon-Sorokin Helgason Ko Priest Tourasse-Helgason
ATCC10987B.cereus ATCC10987 (AH75)Dairy products, Cheese (1930)CanadaTicknor et al. 2001 (AFLP1)Helgason et al. 2000Candelon-Sorokin Helgason Ko Priest Tourasse-Helgason
AH251B.thuringiensis kenyae BGSC4F3 (AH251, AH1302, HD293)Animal, Insect, Almond moth (Ephestia cautella/Cadra cautella)USA  Helgason Tourasse-Helgason

FASTA format for MLST sequences:
>adk
ATGCATGAAGTAGCGATCAGCATGATGA
GATGATACACGTACGTACAGACTAGCAT
...
>glpT
GTACGTAGGGGACAGTACTTACATCATG
CGCGTACCACAGTACAGTTTACATGACC
...

Newick/NewHampshire format for AFLP/MLEE phylogenetic trees:
((B.thuringiensis_KBBB6:50.000000,((((B.anthracis_A0442:32.000000,B.cereus_R_3039/03:32.000000):1,
B.c_group_AH1123:33.000000):9.000000,B.c_group_AH544:42.000000):7.000000,(B.thuringiensis_T08009:12.000000,
B.thuringiensis_HD530:12.000000):37.000000):1):2.000000,((B.thuringiensis_164-S-1:0.000000,B.c_group_C3o32:0.0):22.000000,
B.cereus_04S_00334:22.000000):30.000000);

NEXUS/PAUP format for AFLP/MLEE phylogenetic trees:
#NEXUS

BEGIN TREES;
TREE = AFLP_tree.nex ((B.thuringiensis_KBBB6:50.000000,((((B.anthracis_A0442:32.000000,B.cereus_R_3039/03:32.000000):1,
B.c_group_AH1123:33.000000):9.000000,B.c_group_AH544:42.000000):7.000000,(B.thuringiensis_T08009:12.000000,
B.thuringiensis_HD530:12.000000):37.000000):1):2.000000,((B.thuringiensis_164-S-1:0.000000,B.c_group_C3o32:0.0):22.000000,
B.cereus_04S_00334:22.000000):30.000000);
END;

MLST+AFLP+MLEE Oslo Home